Thursday, June 21, 2012

DNA Sentences

Okay here is my sentence in DNA form:

TTAATACCTATGATGGGATCTTAGTCTGCTCATCCCGG

Thursday, June 14, 2012

Historical Influences on Charles Darwin


Charles Darwin
Thomas Malthus




















1.      I would say that the person who had the most influence over Charles Darwin’s hypothesis of natural selection was Thomas Malthus. I believe this influence to be a positive one in that his ideas in his Essay on the Principle of Population helped Darwin make the connection between evolution and survival: natural selection.


2.      Thomas Malthus is credited with the idea that the larger a population becomes, the harder it would be to sustain it; creating a need for more resources which could inevitably threaten the very existence of said population, whether it is referring to humans or animals. Malthus certified the idea that humans and animals can and will reproduce faster than resources leading to competition for survival. Malthus argued that plagues, catastrophes, and war should all be regarded as God’s way of checks and balances regulating the growth rate of human beings, especially those humans who reside at the lower end of the economic scale. He also insisted that in order to avoid devastation through mass causality catastrophes, poor families who were unable to obtain resources as easily as other families should be mandated by law to have fewer offspring. Our textbook explains that although Malthus was a great influence on Darwin, “he was arguing for limits to human population growth” not evolution (34). Malthus’ ideas may seem rude and outdated today, but during the time he was increasingly aware and concerned at the rate humans were procreating. The website allaboutscience.org helps exonerate Malthus’ seemingly perverse conception about human life being destroyed as a positive aspect of God’s will by explaining that “Malthus lived during times of great overpopulation in a small, island nation. The threat of overcrowding to the British at this time was no small matter” (All About Science). Malthus was an economist and the site points out that he was concerned about the social conditions of the poor, which helps to explain and understand his point of view regarding overpopulation and concerns for lower-class citizens.



3.      There are several bullet points which support the idea that Malthus had a profound impact on Darwin’s natural selection theory.

                                i.            All organisms have the potential of reproducing exponentially: The concept that humans and animals will reproduce unchallenged by other factors is derived from Malthus Population. Charles Darwin took this concept and applied it to all living organisms, broadening the subject of reproduction outside of just humans and animals.

                              ii.            What is preventing organisms from reproducing at their potential: The question is answered by Malthus idea that life can only sustain itself based on the number of resources available, and the threat of populating past capacity of resources will threaten the existence of the population. Darwin interprets this as the reason why organisms are not reproducing at their level of ability and furthers the idea of survival of the fittest, which leads to his theory of natural selection.

                            iii.            Resources are limited: As mentioned above, resources: food, water, housing, are limited. Malthus shows how populations should be controlled because of the limitations of resources. Darwin applies this idea for the reason of evolution.

                            iv.            Organisms with better access to resources will be more successful in their reproductive efforts: Malthus uses his argument to try to persuade a ban or limitation of reproduction of those who are poor and have less access to resources. The poorer population is the organism with fewer accesses to resources so therefore should have less reproductive success.

                              v.            Who gets better access to these limited resources: In Malthus’ study the people with better access would be the more established people of wealth and class. For Darwin, the ones who have better access are the ones who are more “fit” for the environment in which they live, adapting to change through genetic heredity and evolution. It is the organism that is more “fit” that will have better reproductive success.

4.      Could Darwin have reached his theory of natural selection without reading Malthus? The answer to that is not certain; however, the very fact that he did read Malthus and openly stated “I happened to read… Malthus on Population, and being well prepared to appreciate the struggle for existence which everywhere goes on from long- continued observation of the habits of animals and plants, it at once struck me that under these circumstances favourable variations would tend to be preserved, and unfavourable ones to be destroyed. The results of this would be the formation of a new species. Here, then I had at last got a theory by which to work" shows how Darwin’s idea of natural selection was initially sparked by Malthus’ Population (Charles Darwin). Darwin knew that evolution took place and he saw it in multiple studies like the Galapagos Island Finches, yet he did not have a theory of why it occurred until encountering Malthus’ Population. The ideas that Malthus presents in his essay allowed Darwin to work with a theory of why the finches of the Galapagos Islands changed, and how they all originated from the mainland. Following Malthus idea of populations and reproductive success based on the ability to obtain resources, Darwin made the connection that evolution occurs so that the organism can gain access to the resources controlled by the environment and environmental changes. Simply, the finches of the islands changed to allow them better access to food and other resources not only because the islands environment was different from the mainland, but also as the climate changed the birds changed as well. Evolution is the process of changing our dynamics to be better “fit” for environmental changes to ensure maximum potential for reproductive success.

5.      The attitude of the church and the cultural issues of the time greatly hindered Darwin’s willingness to publish The Origin of Species. Not only did the theory of evolution threaten the biblical context of the creation story and the churches authority, it also came at a time of great political strife with The Reform Movement, which sought equality in an unequal society. Our textbook shows that the Reform Movement had many radical factions who were supporters of Lamarck’s ideas and produced anxiety about evolutionist creating atheist. The general consensus and fear of the time was that evolution theory would destroy “the moral fabric of society… and civilized man would return to savagery” (qtd in Introduction to Physical Anthropology 36). The social, political, and religious pressures surrounding the time period, understandably, made Darwin drag his feet in publishing his book. It was not until he felt competition from a fellow scientist by the name of Alfred Russel Wallace that Darwin finally published The Origin of Species worrying that Wallace would be recognized for the theory of natural selection. Darwin’s delay in publication allowed him to further work on his hypothesis and provide a well-establish, thoroughly research theory that may have not existed if he prematurely published his findings too early.